You are viewing the site in preview mode

Skip to main content

Advertisement

Fig. 3 | Journal for ImmunoTherapy of Cancer

Fig. 3

From: Persistent mutant oncogene specific T cells in two patients benefitting from anti-PD-1

Fig. 3

T-cell recognition of AKT1 E17K mutation in MMRp CRC-010 with stable disease after anti-PD-1 treatment. Individual 10-day peptide-stimulated cultures identified long-lived mutation associated neoantigen-specific clonotypes (described in methods) detectable in the blood of patient CRC-010 3 years after developing stable disease following PD-1 blockade: a The TGTGCCAGCAGTGACTCCTGGGGCGCGGATGGCTACACCTTC clonotype, which recognized the HLA-A*23:01-restricted AKT1 E17K-derived KYIKTWRPRYF peptide neoantigen (CRC8, left panel), was detected in the original resected tumor (center panel) and expanded in the periphery upon pembrolizumab treatment (right panel). Data are shown as the number of cells detected after the 10 day culture (abundance) for cultured cells and the relative frequency (%) of each clonotype among all cells detected by TCRseq for FFPE tumor tissue and serial peripheral blood samples. b Duplicate binding assays were performed on the putative neoantigen and wild type counterpart, as well as the known HLA A*23:01-restricted EBV PYLFWLAAI epitope as a positive control. Data are shown as mean counts per second, with error bars representing the standard deviation. c The lollipop plot shows the position of the patient’s AKT1 E17K mutation among the other oncogenic mutations within the AKT1 gene; green: missense mutations, black: truncating mutations, brown: inframe mutations, purple: other

Back to article page